Legacy README (full manual). For the short GitHub front door, see
README.mdon GitHub: https://github.com/omniscoder/Helix/blob/master/README
Omnis Helix — The Genome IDE (Helix kernel + CLI)
Omnis Helix is the Visual Studio of bioinformatics: a snapshot-driven IDE that helps labs run tight CRISPR/Prime design loops — design → simulate → compare → report — with deterministic replays and exportable, provenance-stamped artifacts. PCR and Lightcone GPU viz now ship alongside CRISPR/Prime.
Under the hood is the Helix kernel + headless CLI: the same simulation + reporting contract, runnable in CI/pipelines and exportable into HTML/PNG/JSON evidence bundles.
👉 Public docs: https://helix-studio.com/docs/helix/ 👉 Strategy Playbook: docs/omnis_helix_strategy 👉 Snapshot Spec v1: docs/snapshot_spec_v1 👉 Headless CLI: docs/cli_headless 👉 UI/Theming Instructions: docs/instructions 👉 Studio/CLI reports: see quick commands below 👉 Changelog: https://github.com/omniscoder/Helix/blob/master/CHANGELOG 👉 Scientific Contract: docs/scientific_contract_v1
Tests: use tools/test.sh (Linux/macOS) or tools/test.ps1 (Windows). These are the only supported test entrypoints. GPU/Lightcone lanes are opt-in via env flags (see runbooks/lightcone_runbook.md).
Why Helix Is Auditable (TL;DR)
- Audit in minutes: follow the Audit Walkthrough (hash check →
helix verify --kind auto→ read taint/trust). - Contracts baked in: scientific contract + D2 fixtures live in
repro/scientific_contract_v1/(see docs/scientific_contract_v1). - Conformance on demand:
./tools/conformance.shruns the D0/D1 packs; add to any CI lane. - Longevity promise: bundles remain verifiable for 5 years; see docs/policies/longevity.
- Plugin governance: signed/tainted plugin rules in docs/policies/plugin_governance.
- D2 replay guard: distribution-check fixture and replay requirements shipped with the contract bundle (
bundle_d2/verify.sh). - One-command trust check:
helix trust check --backend cpu-reference(uses repro spec) → PASS banner or a focused diff + policy hash.
Model Limitations (CRISPR Edit DAG)
- DSBs are modeled as instantaneous transitions; no continuous-time kinetics or latent repairable states.
- Probability mass is conserved within modeled outcomes; cell death, arrest, and large-scale genome instability are out-of-scope.
- “No Edit” collapses multiple kinetic failure modes into a single terminal.
- “PAM softness” is an abstract parameter, not a binding-energy or kinetic-rate model.
- Dominant-path visualization is a convenience; tail-risk outcomes are not visualized.
Full limitations and invalid regimes: docs/model_limitations/crispr_edit_dag_limitations.
First Run (copy/paste, ~2 minutes)
Goal: install → open a demo session → export a report.
macOS/Linux:
python -m venv .venv
source .venv/bin/activate
pip install "helix-governance"
curl -L -o demo_session.helix https://raw.githubusercontent.com/omniscoder/Helix/v1.0.2/docs/demo/demo_session.helix
helix-cli report --session demo_session.helix --outdir reports_demo/
python -m http.server --directory reports_demo 8000
Windows (PowerShell):
python -m venv .venv
.venv\\Scripts\\Activate.ps1
pip install "helix-governance"
Invoke-WebRequest -Uri https://raw.githubusercontent.com/omniscoder/Helix/v1.0.2/docs/demo/demo_session.helix -OutFile demo_session.helix
helix-cli report --session demo_session.helix --outdir reports_demo\\
python -m http.server --directory reports_demo 8000
If you want the GUI: pip install "helix-governance[studio]" then launch omnis-helix and click Open CRISPR demo. Lightcone panel ships behind the same extra; GPU path requires NVIDIA OpenGL (see runbooks/lightcone_runbook.md).
Latest release: v1.0.2 – “Partner eval + intake pipeline”
- One-command partner evaluation:
helix partner run --outdir out --with-support-bundle --json-out out/partner_run.json - Intake + ledger automation:
tools/partner_intake.py --partner-run … --json-out … --strictplustools/partner_case.pyandtools/partner_followup.py - Repro bundle v1 + backend parity:
helix run --out repro_out --backends allandhelix verify --kind repro repro_out - Lightcone GPU + audit packs: Studio Lightcone panel exports audit zips; verify with
tools/lightcone_verify_audit_pack.py - Design Partner pack ships in
design_partner/and release assets
Why Helix?
- End-to-end edit DAGs – CRISPR, Prime, and PCR simulations all produce explicit edit DAGs with per-node genome materialization, log-probabilities, and provenance. The same artifacts drive notebooks, PNGs, and interactive web/desktop viz.
- Blueprint-level provenance – every DAG, PNG, and
.viz.jsonis tagged with schema kind, spec version, SHA-256, and runtime metadata. You can always answer “where did this figure come from?”. - Realtime + batch in one toolkit – run tiny “bench” genomes in a notebook, or stream full edit DAGs into a GUI / Playground via JSONL frames for live inspection.
- Formal verification hooks – optional VeriBiota integration re-encodes Helix DAGs in Lean and proves structural + probabilistic invariants. If the badge is green, the math checked out.
- Teaching-friendly, research-grade – small, inspectable examples and clear CLI affordances, but under the hood you get FM-indexes, De Bruijn graphs, MinHash/HLL, prime editing physics, and CRISPR scoring engines.
Why Helix Is Auditable
- Explicit, enforced contract — policy + semantics are schemaed, hash-pinned, and embedded in every artifact header; determinism class is required.
- Determinism with receipts — D0/D1 comparators plus D2 distribution checks (topKMass, entropy, noEditRate, scoreQuantiles, probMassSum) with tolerances and mass conservation.
- Replay you can trust — optional deterministic replay via
replaySampler: module:callable, import-hardened; logs showreplay_used,sampler_available,seedDomain, and sampler id; provenance records the replay op. - Trust/taint enforcement — plugin- or viz-derived data cannot silently upgrade trust; verifier fails if headers or trust labels don’t align.
- CI proof —
repro/scientific_contract_v1/bundle_d2/verify.shruns in CI (optional pass + strict fail) to guard against regressions.
Pinned policy profiles (ready to copy)
policies/dev-fast.json— day-to-day D1 determinism, strict float rules, no replay requirement, plugin trust isolation via headers/taint.policies/audit-strict.json— D2 with distribution checks, replay required, headers required, plugin influence rejected, viz transforms enforced.- Studio shows “Policy locked: <name>” when
HELIX_POLICY_PATHis set; CI defaults topolicies/audit-strict.json.
Verified by VeriBiota™
Helix’s CRISPR, Prime, and PCR DAGs carry the Verified by VeriBiota badge when every generated artifact satisfies:
- Structural correctness: unique root, acyclic topology, monotonic depth, and rule-consistent transitions.
- Semantic correctness: every edit event matches the formal CRISPR/Prime/PCR rewrite semantics tracked in Lean.
- Probability sanity: outgoing probabilities and terminal probabilities sum to ≈1 with no negative or undefined weights.
- Reproducibility: deterministic replays under recorded seeds, provenance-aligned frame streams, and matching sequence hashes.
The contract is documented in docs/veribiota and enforced by the helix veribiota lean-check, preflight, and export-dags commands + the veribiota.yml GitHub Action badge above. If you see the badge, the math has run.
What Helix Is
- Think of Helix as:
- A computational wet lab you can run in a notebook.
- A CRISPR/Prime/PCR digital twin simulator using deterministic rules and DAGs.
- A teaching toolkit for genomics algorithms and bioinformatics basics.
- A bridge into OGN, sharing concepts and API style while staying lightweight and experimental.
Everything Helix emits is a software artifact: JSON, PNG, YAML, GraphML, viz-specs, or CLI summaries. No wet-lab instructions. No reagent guidance.
Highlights
Core genome + sequence tools
- DNA summaries, k-mer counting, GC skew, motif clustering
- FM-index search + approximate search via Myers bit-vector
- Minimizers, syncmers, and seed-extend demos
- ORF detection, frameshift heuristics, translation, protein metrics
RNA folding + ensembles
- Zuker-style MFE
- McCaskill partition function
- Ensembles, dot-plots, entropy tracks, centroids structures
CRISPR simulation stack
- Guide discovery with PAM registries
- Off-target scanning (exact + mismatch-tolerant)
- Probabilistic CRISPR cut/repair simulation
- Edit DAGs (helix.crispr.edit_dag.v1.1) with node-level genome snapshots
- Multi-guide, region-specific, FASTA-native support
- Real-time JSONL frames for animation + Playground sync
- Protein-impact annotation via transcript models
Prime editing simulator
- pegRNA + Prime Editor definitions
- RTT/RTT-branching logic
- Outcome probabilities
- Full Prime Edit DAGs with per-node genome materialization
- Multi-peg batch workflows for large design sets
- PCR Amplicon DAGs
PCR amplicon DAGs
- Primer binding + per-cycle branching
- Amplicon growth simulation
- Visualization + JSON artifact export
Graphs & sketching
- Build/clean/color De Bruijin graphs
- MinHash/HLL Sketching for fast genome distance
Reproducible visualization
- Viz-spec system (structured spec, SHA-verified)
- Every PNG ships a provenance sidebar + sibling .viz.json
- CLI + notebook-friendly
Workflows & experiments
- YAML-driven experiments: CRISPR, Prime, PCR
- Generates DAGs, PNGs, reports, provenance manifests
- Reproducible from a single .helix.yml
GUI + realtime viz
- Optional PySide6 desktop shell
- Cytoscape/D3 visualization of live edit DAG streams
- Offline-capable; accepts CLI artifacts and real-time frames
Studio / CLI report exports
- Save a multi-run session from Studio as
.helix, then:- All runs:
helix-cli report --session my_session.helix --outdir reports/ - Single run:
helix-cli report --session my_session.helix --run-id demo_crispr_g2 --outdir reports/
- All runs:
- Each HTML report includes guide info, physics + backend (GPU/CPU), outcomes JSON + CSV, and run metadata (project/sample/author/run_id).
Headless simulation + reports
- Simulate from a JSON config into a session file:
helix-cli simulate guides.json batch.helix - Append more runs:
helix-cli simulate more_guides.json batch.helix --append - Then export reports (all or filtered by run_id) with
helix-cli report ...as above. - Config schema documented in
docs/cli_config_schema.md(CRISPR + PRIME viaprime.pbs_sequence/prime.rt_sequencefields). - Quickstart demo: open
docs/demo/demo_session.helixin Studio or runhelix-cli report --session docs/demo/demo_session.helix --outdir reports_demo/.
Benchmarks & validation
- Quick throughput check:
helix-cli bench --backend gpu(prints CRISPR MPairs/s and PRIME preds/s) - Validation scaffold: see
docs/validation/README.md(datasets/metrics to be filled as we publish comparisons).
Visual regression (EVS → PNG)
- Install dev deps (in a venv):
python -m pip install -r requirements-dev.txt - Run visual tests headless:
HELIX_RUN_EVS_VISUAL=1 QT_QPA_PLATFORM=offscreen tools/test.sh -q tests/evs_visual(Windows:powershell -ExecutionPolicy Bypass -File tools/test.ps1 -q tests/evs_visual) - Quick smoke:
scripts/run_evs_visual_smoke.sh - Add/refresh goldens: see
docs/evs_visual.md/docs/evs_visual_tests.md
Screenshots (docs/img)
- omnis_helix_start_1920x1080.png — Start panel with CRISPR/Prime demos
- omnis_helix_evs_overlay_1920x1080.png — Outcome Explorer overlay (CRISPR baseline vs Prime candidate)
- omnis_helix_prime_inspector_1920x1080.png — Prime demo with RTT/PBS inspector rail



Quick Start
Crispr Edit DAG
helix crispr dag \
--genome genome.fna \
--guide-sequence GGGGTTTAGAGCTATGCT \
--json crispr_dag.json
Prime Editing Simulator
helix prime dag \
--genome genome.fna \
--peg-config peg.json \
--editor-config pe3.json \
--json prime_dag.json
PCR Amplicon DAG
helix pcr dag \
--genome plasmid.fna \
--primer-config primers.json \
--pcr-config pcr_settings.json \
--out pcr_dag.json
Rendered edit DAGs (examples)
Helix ships a couple of reference DAG renders so you can see the provenance‑stamped figures users will get from the CLI.
Regenerate them yourself with the bundled example payloads:
python -m helix.cli edit-dag viz --input examples/crispr_edit_dag.json --out docs/img/crispr_dag.png
python -m helix.cli edit-dag viz --input examples/prime_edit_dag.json --out docs/img/dag.png


RNA Folding
helix rna mfe --fasta hairpin.fna --dotbracket mfe.dbn
helix rna ensemble --fasta hairpin.fna --gamma 1.0 --dotplot plot.png
Sequence Tools
helix dna --input seq.fna --window 400 --k 5 --plot-skew
helix seed index seq.fna --method minimizer --k 15 --plot seeds.png
helix string search seqs.fna --pattern GATTACA --k 1
Engine Backends
CRISPR and Prime editing share the same encoded physics boundary, so every
simulator and CLI call can swap kernels without touching call sites. Pick one of
the following backends per run (details + throughput numbers live in
docs/engine_architecture.md):
cpu-reference– pure Python reference implementation, always available.native-cpu– pybind11 extension fromsrc/helix_engine, fastest on CPUs.gpu– CUDA build of the same kernels for machines compiled withHELIX_ENGINE_ENABLE_CUDA=ON.
Prime editing mirrors the same backend preference automatically so both engines emit consistent artifacts.
Selecting a Backend
Set the backend globally with environment variables:
HELIX_CRISPR_BACKEND/HELIX_PRIME_BACKEND→cpu-reference,native-cpu, orgpu.HELIX_CRISPR_ALLOW_FALLBACK/HELIX_PRIME_ALLOW_FALLBACK→1enables automatic fallback to the Python reference backend when the requested engine is unavailable;0keeps failures loud.
CLI helpers accept the same knobs:
helix crispr dag \
--engine-backend gpu \
--engine-allow-fallback \
--genome genome.fna \
--guide-sequence GGGGTTTAGAGCTATGCT \
--json crispr_dag.json
Studio inherits the process environment, so the same settings power live viz.
Use helix engine info (or python -m helix.cli engine info) to see the
resolved backend + fallback behavior that will be stamped into artifacts:
$ helix engine info
{
"selected_backend": "native-cpu",
"allow_fallback": false,
"native_available": true,
"native_backend": "available",
"env_backend": null,
"env_allow_fallback": null
}
Native backend availability (Path B)
- A compiled
helix_engine._nativewheel ships for CPython 3.12. If it is present,helix engine infoshowsnative_backend: available; otherwise it reportsmissing. - Developers can force tests to require the extension by running with
HELIX_REQUIRE_NATIVE=1; the suite will fail fast if the module is absent. - CI has a dedicated
tests-native-backendjob that builds/loads the native backend and runs the native-focused tests to prevent silent bitrot. - Studio shows a status-bar hint (
native backend: available/missing) so you can tell at a glance which path you’re on.
Performance Benchmark
helix engine benchmark reproduces the CRISPR/Prime workloads from
docs/engine_architecture.md. It prints a human-readable table and can emit
JSON when you want to compare against CI/doc baselines.
helix engine benchmark
helix engine benchmark --backends cpu-reference native-cpu --json helix_benchmark.json
Sample output:
CRISPR throughput (MPairs/s)
requested actual G N L MPairs/s
cpu-reference cpu-reference 1 512 20 0.06
native-cpu native-cpu 1 512 20 0.90
Prime throughput (predictions/sec)
backend targets genome spacer preds/sec
cpu-reference 32 2000 20 5634.48
JSON schema (v1) excerpt:
{
"helix_version": "1.0.2",
"scoring_versions": {"crispr": "1.0.0", "prime": "1.0.0"},
"env": {"platform": "...", "python_version": "3.12.3", "cuda_available": false},
"seed": 1,
"config": {"backends": ["cpu-reference"], "crispr_shapes": ["1x512x20"]},
"benchmarks": {
"crispr": [{"backend_requested": "cpu-reference", "shape": "1x512x20", "mpairs_per_s": 0.06}],
"prime": [{"workload": "32x2000x20", "predictions_per_s": 5634.48}]
}
}
The full schema is documented in docs/engine_architecture.md.
GPU Backend (Experimental)
Helix ships CPU-only wheels on PyPI. To try the CUDA backend locally:
- Install CUDA toolkit + drivers (12.x tested).
- Build the native extension:
./scripts/build_native_cuda.sh - Verify it works:
HELIX_CRISPR_BACKEND=gpu helix engine benchmark --backends gpu --json gpu_benchmark.json
If _native*.so is missing, the CLI automatically falls back to the Python
reference backend and records the actual backend that ran. Lightcone GPU
rendering also requires NVIDIA OpenGL; see runbooks/lightcone_runbook.md for the
pinned-runner expectations.
Prime Physics Scoring
Prime simulations can surface physics heuristics (PBS ΔG, microhomology, flap
competition) by enabling --physics-score:
helix prime simulate --physics-score --json prime.json \
--genome genome.fna \
--peg-config peg.json \
--editor-config editor.json
Each payload now carries a physics_score block:
"physics_score": {
"pbs_dG": 2.50,
"flap_ddG": 2.30,
"microhomology": 1,
"P_RT": 0.182,
"P_flap": 0.373,
"E_pred": 0.054
}
See docs/prime_physics.md for a deep dive on each term and how to interpret
them when ranking peg designs.
Building with CUDA (Optional)
The CUDA backend ships in src/helix_engine. Build it with CMake and enable the
toggle mentioned in docs/engine_cuda_plan.md:
cmake -S src/helix_engine -B build/helix_engine -DHELIX_ENGINE_ENABLE_CUDA=ON \
-DPython_EXECUTABLE="$(which python)"
cmake --build build/helix_engine --target helix_engine_py
cp build/helix_engine/helix_engine_py.*.so \
src/helix_engine/_native$(python3-config --extension-suffix)
Once _native*.so is on PYTHONPATH, HELIX_CRISPR_BACKEND=gpu helix ... will
exercise the CUDA kernels; helix_engine.native.cuda_available() reports the
hardware status.
Scoring Versioning & Metadata
Helix freezes its physics numerics via CRISPR_SCORING_VERSION and
PRIME_SCORING_VERSION. Every artifact stamped by the simulators or CLI exports
carries:
crispr_engine_backend/prime_engine_backendcrispr_scoring_version/prime_scoring_version- runtime fields such as
helix_version, timestamps, command replay
Example snippet:
"meta": {
"helix_version": "1.0.2",
"crispr_engine_backend": "gpu",
"crispr_scoring_version": "1.0.0",
"prime_engine_backend": "cpu-reference",
"prime_scoring_version": "1.0.0"
}
If you deliberately change scoring math, bump the scoring version, refresh the golden fixtures, and update the release notes.
Reproducible Viz (Spec 1.x)
Every plot:
- stamps a provenance footer (Helix version, SHA-256, viz kind)
- emits a .viz.json viz-spec
- stores full command replay in <image>.provenance.json Use:
helix viz --schema
helix schema manifest
helix schema diff old.json new.json
Workflows
Turn a single YAML file into a full simulation:
helix experiment new --type crispr --out demo.helix.yml
helix experiment run --config demo.helix.yml --out dag.json
helix experiment viz --config demo.helix.yml --out dag.png
Everything—FASTA, guides, Cas config, seed, viz parameters—is captured and reproducible.
Repo Layout
src/helix/
crispr/ # CRISPR models, guides, simulators, edit DAGs
prime/ # Prime editing engine + DAGs
pcr/ # PCR amplicon simulator
rna/ # MFE + ensemble folding
bioinformatics/ # DNA utilities, k-mers, motif clustering
seed/ # minimizers/syncmers + mapping demo
string/ # FM-index + Myers ED
graphs/ # DBG tooling
viz/ # spec-driven visualization system
workflows/ # YAML runner
gui/ # optional PySide6 desktop app
benchmarks/
docs/
examples/
tests/
Getting Started
Requirements
- Python 3.10+ (3.12 tested)
- pip or another package manager
- Optional extras:
matplotlibfor plotting,biopythonfor protein helpers,pyyamlfor workflow configs (already included in base deps).
Installation
Stable release from PyPI (installs CLI + package):
python -m venv .venv
source .venv/bin/activate
pip install "helix-governance[viz,protein,schema]"
Need only the core library? Drop the extras (viz/matplotlib, protein/Biopython, schema/pydantic). For local development, clone the repo and run:
pip install -e ".[dev]"
This exposes the helix console command and the helix Python package (from helix import bioinformatics).
Run a Script
-
K-mer + skew analysis
helix dna --input path/to/sequence.fna --window 400 --step 50 --k 5 --plot-skewChange the GC window/step, filter top k-mers, or point at the bundled dataset
src/helix/datasets/dna/plasmid_demo.fna. For quick clustering with exports, trypython examples/kmer_counter.py --max-diff 1 --csv clusters.csv --plot-top 10. -
Neural net demo
python ann.pyPrints training progress and final weights for a tiny XOR-style problem.
-
Translate a sequence
python examples/translate_sequence.py AUGGCCUUUAdd
--no-stopto continue through stop codons or point to a file with--input. -
Find ORFs
python examples/find_orfs.py --min-length 90 --include-partial --detect-frameshifts --input your_sequence.fna --orf-fasta peptides.faa --orf-csv orfs.csv --frameshift-csv shifts.csvPrints coordinates, frames, strands, optional frameshift candidates, and can export FASTA/CSV artifacts.
-
Cyclo-spectrum playground
python examples/cyclospectrum_demo.py --peptide NQEL --spectrum "0,113,114,128,227,242,242,355,356,370,371,484"Print linear/cyclic spectra, score against an experiment, or recover candidate peptides with the leaderboard search.
-
RNA folding trace
python examples/nussinov_trace.py --input hairpin.fasta --min-loop 4Outputs the dot-bracket structure, base-pair list, and optional file export using the upgraded Nussinov implementation.
-
Protein summary
helix protein --input src/helix/datasets/protein/demo_protein.faa --window 11 --top 8Computes molecular weight, charge, hydropathy windows, and more (requires the
proteinextra / Biopython). -
Unified Helix CLI
helix dna --sequence ACGTACGT --k 4 helix spectrum --peptide NQEL --spectrum "0,113,114,128,227,242,242,355,356,370,371,484" helix rna mfe --fasta src/helix/datasets/dna/plasmid_demo.fna --dotbracket mfe.dbn helix rna ensemble --fasta src/helix/datasets/dna/plasmid_demo.fna --gamma 1.0 --dotplot dotplot.png --entropy entropy.pngThe
helixentry point wraps the DNA, spectrum, RNA, protein, triage, viz, and workflow helpers so you can run ad-hoc analyses without hunting for scripts. -
CRISPR guide + off-target scan
helix crispr find-guides --fasta target.fna --pam SpCas9-NGG --guide-len 20 --json guides.json helix crispr offtargets --fasta genome.fna --guides guides.json --max-mm 3 --json hits.json helix crispr score --guides guides.json --hits hits.json --weights weights/cfd-lite.json --json scores.json helix crispr simulate --fasta target.fna --guides guides.json --guide-id g1 --draws 1000 --seed 42 --json crispr_sim.json helix viz crispr-track --input crispr_sim.json --save crispr_track.pngProduces schema-tagged JSON (
crispr.guides,crispr.offtargets,crispr.sim) with optional scoring and cut/repair simulations; CLI viz renders a provenance-stamped PNG. Sequences remain masked unless--emit-sequencesis explicitly passed. -
CRISPR genome simulation
helix crispr genome-sim --genome genome.fna --guide-sequence GGGGTTTAGAGCTATGCT --cas cas9 --json crispr_cut_events.jsonLoads the genome into a
DigitalGenome, instantiates a preset (or JSON-defined)CasSystem, and calls the in-silico cut simulator so you can inspect potential target sites. Outputs include serialized guides, Cas parameters, and any simulatedCutEvententries. -
CRISPR edit DAG
helix crispr dag --genome genome.fna --guide-sequence GGGGTTTAGAGCTATGCT --max-depth 1 --json crispr_edit_dag.jsonBuilds the first-version “digital twin” graph using the new edit runtime. Nodes contain fully materialized genome views, edges capture each clean-cut event, and the JSON artifact (
helix.crispr.edit_dag.v1.1) can feed notebooks and future viz surfaces. -
CRISPR edit DAG (FASTA-native, multi-guide)
helix crispr dag \ --genome examples/hg19_chr_demo.fa \ --cas-config examples/cas9.json \ --guides-file examples/guides.tsv \ --region chr7:55000000-55005000 \ --max-depth 2 \ --min-prob 1e-4 \ --max-sites 20 \ --seed 0 \ --out-dir out/crispr_dags/cas9.json(Cas/physics config){ "name": "SpCas9", "system_type": "cas9", "pam_pattern": "NGG", "cut_offset": 3, "max_mismatches": 3, "weight_mismatch_penalty": 1.0, "weight_pam_penalty": 2.0 }guides.tsv(guide library)name sequence region G1 ACGTACGTACGTACGTACGT chr7:55000010-55000040 G2 TGCATGCATGCATGCATGCA chr7:55003000-55003025 G3 CCCCCGGGGGAAAAATTTTT .
The CLI slices the FASTA per guide (falling back to
--region), fans out over each design, and writes one artifact per guide (e.g.,out/crispr_dags/crispr_001_G1.edit_dag.json). Artifacts stay compatible with the viz/report/Playground surfaces. -
Protein-impact annotations
helix crispr dag \ --genome examples/hg19_chr_demo.fa \ --guide-sequence ACGTACGTACGTACGTACGT \ --coding-json transcripts/BRCA1_tx.json \ --coding-transcript BRCA1-201 \ --out out/crispr_brca1.edit_dag.jsonProvide a transcript JSON (same schema used by the GUI loader) to annotate SNV outcomes with
protein_impactmetadata (silent,missense,nonsense). Works for bothhelix crispr dagandhelix prime dag. -
Prime editing sandbox
helix prime simulate --genome genome.fna --peg-config peg.json --editor-config pe3.json --max-outcomes 16 --json prime_edits.jsonWraps the new prime-editing models: pegRNA definitions (inline flags or JSON), prime-editor parameters, and the
simulate_prime_editentrypoint. Like the CRISPR command, this is purely computational—it emits hypothetical outcomes for downstream notebooks and viz. -
Prime edit DAG
helix prime dag --genome genome.fna --peg-config peg.json --editor-config pe3.json --json prime_edit_dag.jsonProduces the prime-editing DAG artifact (
helix.prime.edit_dag.v1.1) so you can inspect RTT-driven branches, log probabilities, and materialized genome snapshots per node. -
Prime edit DAG (config-driven, multi-peg)
helix prime dag \ --genome examples/hg19_chr_demo.fa \ --editor-config examples/prime_editor.json \ --pegs-file examples/pegs.tsv \ --region chr11:5227000-5227500 \ --max-depth 3 \ --min-prob 1e-4 \ --seed 0 \ --out-dir out/prime_dags/prime_editor.json{ "name": "PE2-like", "cas": { "name": "SpCas9-H840A", "type": "cas9", "pam_pattern": "NGG", "cut_offset": 3, "max_mismatches": 2 }, "nick_to_rtt_offset": 0, "efficiency_scale": 0.6, "mismatch_tolerance": 2, "indel_bias": 0.1, "metadata": { "flap_model": "left>right (demo)" } }pegs.tsvname spacer pbs rtt region peg1 ACGTACGTACGTACGTACGT GCTAGCTA TCTGACTCTCTCAGGAGTC chr11:5227000-5227100 peg2 TGCATGCATGCATGCATGCA AACCGGTT AAGGTTCCGGAACTTG chr11:5227200-5227300
Each peg row emits a dedicated
helix.prime.edit_dag.v1.1artifact, mirroring the CRISPR workflow. The Playground buttons (?demo=prime) load the same format, so teams can plug their configs directly into visualization/reporting pipelines. -
Experiment configs (YAML → DAG)
helix experiment new --type crispr --out experiments/demo_crispr.helix.yml helix experiment run --config experiments/demo_crispr.helix.yml --out out/demo_crispr.edit_dag.json helix experiment viz --config experiments/demo_crispr.helix.yml --out out/demo_crispr.pngA
*.helix.ymlfile captures everything humans care about—FASTA path, optional region, Cas/Prime config, guide or peg design, and simulation knobs. Helix regenerates DAG JSON, PNGs, and HTML reports from that single spec (helix experiment run/viz/report). Starter templates live intemplates/, andhelix experiment newbootstraps a fresh config with placeholders ready to fill in. -
Real-time DAG frames (JSONL)
helix crispr dag \ --genome examples/hg19_chr_demo.fa \ --cas-config examples/cas9.json \ --guide-sequence ACGTACGTACGTACGTACGT \ --frames - \ --out out/crispr_rt.edit_dag.jsonStreams
helix.edit_dag.frame.v1JSON lines so you can animate CRISPR edits as they unfold. See Edit DAG Frames for schema details, or try it live in the Realtime Playground. -
CRISPR DAG micro-verification
python benchmarks/verify_crispr_micro.py tools/test.sh tests/test_crispr_dag_micro.pyA synthetic
tests/data/crispr_micro.fnagenome (two short chromosomes packed with overlapping NGG PAMs) powers a brute-force verifier that rebuilds the entire probability tree outside of the CRISPR physics engine. Thebenchmarks/verify_crispr_micro.pyscript emits a pass/fail summary, whiletests/test_crispr_dag_micro.pyruns the same cross-check during CI so we know every DAG leaf and probability mass matches the reference enumeration. -
Lean/VeriBiota bridge
helix crispr dag --genome genome.fna --guide-sequence ACGT... --json out/eg.edit_dag.json helix veribiota export \ --input out/eg.edit_dag.json \ --out out/eg.lean \ --dag-name exampleDag \ --module-name VeriBiota.BridgeConverts any Helix
helix.*edit_dag.v1.*artifact into a Lean module that definesexampleDag : EditDAG, emits the node/edge lists, and inserts a ready-to-run#eval VeriBiota.check exampleDagplus a theorem stub (disable with--skip-theorem/--skip-eval).To consolidate several JSON artifacts into one Lean namespace (faster CI, shared proofs):
helix veribiota export-dags \ --inputs out/dag1.json out/dag2.json \ --module-name Helix.CrisprExamples \ --list-name exampleDags \ --out veribiota/generated/Helix/CrisprExamples.leanThe generated module defines
def dag1 : EditDAG,dag2, bundles them intodef exampleDags : List EditDAG, and inserts an aggregate theorem stub (∀ dag ∈ exampleDags, VeriBiota.check dag) you can turn into a real proof. -
Lean pipeline glue
helix veribiota lean-check --input out/dag1.json --out out/dag1.lean-check.json helix veribiota preflight --checks out/*.lean-check.json helix veribiota export-dags --inputs out/dag*.json --out veribiota/generated/Helix/CrisprExamples.leanEach DAG JSON gets a companion
.lean-check.json(hashes, probabilities, metadata).preflightvalidates those summaries (and, optionally, re-hashes the source DAGs) so CI fails fast before Lean boots. Once preflight passes,export-dagsemits a single Lean module for all DAGs, letting VeriBiota prove shared invariants (well_formed, probability sums, hash consistency) in one place.When integrating with the external VeriBiota/VeriBiota repo, point Helix directly at that checkout and let it populate the generated namespace:
helix veribiota export-suite \ --inputs out/dag*.json \ --veribiota-root ../VeriBiota \ --module-path Biosim/VeriBiota/Helix/MicroSuite.lean \ --module-name Biosim.VeriBiota.Helix.MicroSuiteThis writes the Lean file straight into
Biosim/VeriBiota/Helix/MicroSuite.lean, ready for VeriBiota’s Lake build + proof pipeline. -
Frames → dataset
helix edit-dag generate-dataset --n 0 --frames-input run.frames.jsonl --out dataset.jsonlConverts a JSONL frame stream into a dataset record (mix with random generations by combining
--frames-inputand--n). Each row stays human-readable so you can audit what landed in the corpus:{ "id": 7, "mechanism": "crispr", "node_count": 11, "edge_count": 10, "top_outcomes": [ {"stage": "repaired", "prob": 0.61, "sequence_hash": "9f4b1cbe"}, {"stage": "error", "prob": 0.31, "sequence_hash": "72acdc01"} ], "frame_source": "runs/hbb_demo.frames.jsonl", "artifact": { "...": "helix.crispr.edit_dag.v1.1 payload" } } -
Hero comparison (HBB vs mutant)
- Open the Realtime Playground.
- Guide A:
ACCCAGGAAACCCGGGTTTT, Guide B:TTTACCCAGGAAACCCGGGT, PAMNGG. - Hit “Compare” to watch probability mass shift between intended vs indel branches, then export the experiment
.helix.ymlfor reproducible CLI runs.
-
Desktop GUI (optional PySide6 extra)
pip install helix-governance[gui] helix guiShips a PySide6 desktop shell with a QWebEngineView + Cytoscape canvas. The GUI streams the same JSONL frames as the CLI/Playground, so you can iterate on CRISPR or Prime runs locally (even offline) and export specs later.
-
PCR amplicon DAG
python -m helix.cli pcr dag \ --genome src/helix/datasets/dna/plasmid_demo.fna \ --primer-config examples/pcr_primers.json \ --pcr-config examples/pcr_config.json \ --out pcr_amplicon_dag.json python -m helix.cli edit-dag viz --input pcr_amplicon_dag.json --out pcr_dag.pngSimulates in-silico amplification (binding → cycles → error branches) and emits
helix.pcr.amplicon_dag.v1. Drag-drop the JSON into the Playground for an interactive tour or animate it viahelix edit-dag animate. -
Edit DAG visualization
helix edit-dag viz --input examples/crispr_edit_dag.json --out crispr_dag.png helix edit-dag viz --input examples/prime_edit_dag.json --out prime_dag.pngRenders any DAG artifact to a PNG using the built-in networkx/matplotlib helper. The
examples/directory ships ready-to-plot JSON fixtures for CRISPR and Prime editing so you can kick the tires immediately. For an interactive walkthrough (including sequence diffs), opendocs/notebooks/edit_dag_visual_demo.ipynb. -
JSON configs → CLI
# Convert the JSON genome to FASTA on the fly python - <<'PY' > /tmp/demo_genome.fna import json cfg = json.load(open("examples/crispr_demo_genome.json")) for chrom in cfg["chromosomes"]: print(f">{chrom['name']}\\n{chrom['sequence']}") PY GUIDE=$(jq -r '.sequence' examples/crispr_demo_guide.json) helix crispr dag --genome /tmp/demo_genome.fna --guide-sequence "$GUIDE" --json /tmp/demo_dag.jsonThe
examples/crispr_demo_genome.json+examples/crispr_demo_guide.jsonpair provides a self-contained, copy-pastable config for CLI experiments without needing any external FASTA files. -
Prime config quickstart
python examples/scripts/make_prime_demo_fasta.py --input examples/prime_demo_genome.json --out /tmp/prime_demo.fna helix prime dag --genome /tmp/prime_demo.fna \ --peg-config examples/prime_demo_configs.json \ --editor-config examples/prime_demo_configs.json \ --json /tmp/prime_dag.jsonThis uses the bundled
examples/prime_demo_genome.jsonplus peg/editor definitions inexamples/prime_demo_configs.jsonto build a full prime-edit DAG without any external data. -
Workflow runner
helix workflows --config workflows/plasmid_screen.yaml --output-dir workflow_runsChains multiple subcommands from YAML, captures per-step logs, and writes artifacts to structured run directories.
-
Visualization helpers
helix viz triage --json triage.json --output triage.png helix viz hydropathy --input src/helix/datasets/protein/demo_protein.faa --window 11Render plots directly from CLI artifacts (triage JSON, hydropathy windows). Requires matplotlib; hydropathy also needs Biopython.
-
Python API demo
python examples/helix_api_demo.pyShowcases the
helix_apimodule for notebook-friendly access to DNA summaries, triage reports, spectra, RNA folding, and (optionally) protein metrics. For full signatures and payload descriptions, see the API reference. -
Triage report CLI
python examples/triage_report.py --input your_sequence.fna --output triage.png --clusters-csv clusters.csv --orfs-csv orfs.csvGenerates a composite plot plus optional CSV/FASTA exports for quick daily snapshots.
-
Notebook triage dashboard Open
notebooks/triage_dashboard.ipynbto plot GC skew, ORFs, and k-mer hotspots side-by-side for a quick daily scan. -
Protein sequence peek
from protein import show_sequence show_sequence("1CRN.cif")Requires the target structure file in the working directory (or adjust the loader).
Browse task-specific quickstarts in examples/README.md. Tiny datasets ship inside the package (see helix.datasets.available()), including dna/human.txt, dna/plasmid_demo.fna, and protein/demo_protein.faa for quick experiments with pandas, sklearn, or hydropathy charts.
Run Tests
tools/test.sh
powershell -ExecutionPolicy Bypass -File tools/test.ps1
The test suite runs via tools/test.sh (or tools/test.ps1 on Windows) to keep environments deterministic.
Backend parity + repro bundle:
HELIX_RUN_LIGHTCONE_GPU=1 tools/test.sh tests/test_repro_backend_parity.py
Doctor (environment sanity)
python tools/doctor.py
Benchmarks
python -m benchmarks.api_benchmarks --repeat 5 --warmup 1 --limit 0 \
--out bench-results/api.json --summary-md bench-results/api.md
The benchmark harness now emits a schema-stamped payload (bench_result v1.0) that records commit SHA, dataset provenance, BLAS vendor, CPU/threads, locale, RNG seed, and per-case timing/RSS stats. Use --scenario dna_summary to focus on a subset, --limit 10000 to mimic CI’s faster sweep, and --summary-md to capture the Markdown table that CI publishes automatically.
- CI drift tracking: the
benchmarksGitHub Actions job pinsOMP_NUM_THREADS/MKL_NUM_THREADS, seeds RNGs, runs the suite (repeat=3by default,repeat=10whenbench_heavy=trueviaworkflow_dispatch), uploadsbenchmarks/out/bench-$GITHUB_SHA.{json,md}, and appends the rendered Markdown summary to the workflow summary tab. - Regression gate:
scripts/bench_check.py .bench/baseline.json benchmarks/out/latest.json --threshold 5enforces a >+5 % slowdown limit and fails the workflow when hit. Update.bench/baseline.jsonwhenever you intentionally change performance characteristics. - Heavier datasets: export
HELIX_BENCH_DNA_FASTA/HELIX_BENCH_PROTEIN_FASTA(or pass them as workflow_dispatch inputs) to stress-test larger references. The benchmark JSON records the absolute paths and sizes so dashboards can keep apples-to-apples comparisons. Store private or future references underbenchmarks/data/and toggle them viabench_heavy=truewhen ready. - Dashboard: CI appends every main-branch run to
docs/data/bench/history.csv; the published chart lives at docs/benchmarks.
Reproducible Viz & Viz-Spec
- Every
helix viz ...(and CLI modes that call them) accepts--save out.png(PNG/SVG/PDF) and auto-emits a sibling.viz.jsonunless--save-viz-specoverrides the path. - Each plot footer stamps
Helix vX.Y • viz-kind • spec=1.x • key params • timestamp • input_sha256so shared figures always carry their provenance and the SHA-256 of the original JSON payload. - The viz-spec JSON captures counts, quantiles, bounds, and the
input_sha256used for hashing; regressions assert against that structured payload instead of brittle pixel hashes. - You can feed those viz-specs (plus the original JSON inputs) into docs/notebooks to explain how a figure was produced and which parameters generated it.
- Explore or inspect schemas with
helix viz --schema, diff manifests withhelix schema diff --base old.json, export everything viahelix schema manifest --out schemas.json, or render ready-to-plot payloads viahelix demo viz. - Workflows can enforce schemas per step and print provenance tables/JSON with
helix workflows ... --with-schema [--as-json]. - Every saved plot writes
<image>.provenance.jsonnext to the PNG, capturing{schema_kind, spec_version, input_sha256, viz_spec_sha256, image_sha256, helix_version, command}for chain-of-custody. - Full schemas, screenshots, and sample payloads live under docs/viz and the Schema Reference.
Weekend Project Ideas
- Plot the GC skew for a bacterial plasmid and compare predicted origins to literature.
- Extend the ORF scanner to sweep reverse complements and test on viral genomes.
- Compare frameshift candidates against known gene models to flag likely sequencing errors.
- Pair the ORF scanner with the GC skew plot to compare predicted origins and coding regions.
- Use the CSV/plot outputs from
examples/kmer_counter.pyto highlight SNP hotspots and share charts with the community. - Customize
notebooks/triage_dashboard.ipynbwith your own sequences and publish the visuals for project updates (digital reports only). - Hook
cyclospectrum.pyinto a simple leaderboard scorer and visualize the mass differences. - Swap the activation function in
ann.py, log loss curves, and document what changes. - Build a notebook that fetches a PDB entry, prints its sequence via
protein.py, and sketches the secondary structure counts. - Chain
examples/translate_sequence.pywithpeptide_mass_lookup.pyto score translated open reading frames.
Browse ready-to-run snippets in examples/README.md, and share your results in examples/ (add new files freely) or link to gist/notebook URLs in issues so others can remix.
Design Philosophy
- Approachable first: readable code, inline comments when helpful, datasets that fit in memory.
- Composable: functions return plain Python data structures so you can plug them into pandas, NumPy, or future OGN pipelines.
- Biopython-friendly: we stand on Biopython's shoulders; no wheel reinvention when a stable API exists.
- Prototype-to-production bridge: helper scripts should make it easy to migrate successful ideas into OGN when the time comes.
Roadmap
- Real-time 2.5D simulation panels (CRISPR + Prime + PCR)
- Unified DAG viewer with edit-diff timelines
- Notebook-to-OGN adapters for migrating prototypes
- More ensemble RNA metrics + stochastic simulators
- Expanded motif discovery solvers + GPU-ready variants
- Community-driven examples gallery
Contributing
We welcome ideas, experiments, and docs improvements. To keep things playful:
- Open issues with context, references, or notebooks that inspired your idea.
- Tag contributions by complexity (
good-first-experiment,deep-dive, etc.). - Respect the code of conduct (be kind, give credit, document assumptions).
- If you plan a larger refactor, start a discussion thread so we can pair-program or offer pointers.
Happy hacking!
-
String search
helix string search sequences.fna --pattern GATTACA --k 1 --json hits.jsonUses the FM-index for exact matches (
k=0) or Myers bit-vector streaming for ≤k edit-distance hits in FASTA/plaintext inputs. -
Seed + extend demo
helix seed index src/helix/datasets/dna/plasmid_demo.fna --method minimizer --k 15 --window 10 --plot seeds.png helix seed map --ref src/helix/datasets/dna/plasmid_demo.fna --reads src/helix/datasets/dna/plasmid_demo.fna --k 15 --window 10 --band 64 --xdrop 10Generates deterministic minimizers (or syncmers) and a simple seed-and-extend JSON summary;
--plotuseshelix.viz.seedfor density snapshots. -
DBG toolbox
helix dbg build --reads reads1.fna reads2.fna --k 31 --graph dbg.json --graphml dbg.graphml helix dbg clean --graph dbg.json --out dbg_clean.json helix dbg color --reads sample1.fna sample2.fna --labels case control --k 31 --out colored.jsonBuilds/cleans JSON + GraphML de Bruijn graphs and produces colored DBG presence tables ready for pseudoalignment experiments.
-
Motif discovery
helix motif find --fasta promoters.fasta --width 8 --solver steme --iterations 40 --json motif.json --plot pwm.pngRuns EM/STEME/online solvers to infer PWMs/log-likelihoods and renders optional probability heatmaps.
-
Sketching (MinHash/HLL)
helix sketch build --method minhash --fasta seq.fna --k 21 --size 1000 helix sketch compare --method hll --fasta-a a.fna --fasta-b b.fna --precision 12Quickly approximate genome distances via Mash-style MinHash or HLL cardinality/Jaccard estimates.